tetplko puro vector (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
tetplko puro vector
Tetplko Puro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 703 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tetplko+puro+vector/Tet-pLKO-puro+(Plasmid+%2321915)/pm41776172-45-6-8
Average 96 stars, based on 703 article reviews
Tetplko Puro Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 703 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/tetplko+puro+vector/Tet-pLKO-puro+(Plasmid+%2321915)/pm41776172-45-6-8
Average 96 stars, based on 703 article reviews
tetplko puro vector - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Knockdown:Article Title: KDM5A Inhibits Antitumor Immune Responses Through Downregulation of the Antigen-Presentation Pathway in Ovarian Cancer Article Snippet: .. Tet-inducible knockdown of Kdm5a using short hairpin RNA tet-pLKO-shKdm5a was constructed by inserting the sense sequence 50- CCTTTGAGTGACTTAGAGGAA-30 for clone 1 or 50- CAAAGAGAACAAGACGAGTTA-30 for clone 2 into the Article Title: DDX23 is a Metabolic Regulator in Hepatocellular Carcinoma Article Snippet: Lenti-viruses were produced by co-transfection into HEK293FT cells with the pLKO.1 vectors, packaging plasmid psPAX2 (Addgene plasmid 12260, Addgene, Cambridge, MA) and envelope pMD2.G (Addgene plasmid 12259), using the PEI. .. For the doxycycline (Doxy)-inducible DDX23 knock-down, Article Title: PHGDH activation fuels glioblastoma progression and radioresistance via serine synthesis pathway. Article Snippet: .. For the inducible knockdown experiments conducted in vitro, lentiviral constructs that carried doxycycline (DOX)-inducible shRNAs were generated in the shRNA:Article Title: KDM5A Inhibits Antitumor Immune Responses Through Downregulation of the Antigen-Presentation Pathway in Ovarian Cancer Article Snippet: .. Tet-inducible knockdown of Kdm5a using short hairpin RNA tet-pLKO-shKdm5a was constructed by inserting the sense sequence 50- CCTTTGAGTGACTTAGAGGAA-30 for clone 1 or 50- CAAAGAGAACAAGACGAGTTA-30 for clone 2 into the Article Title: A Novel Non-Catalytic Scaffolding Activity of Hexokinase 2 Contributes to EMT and Metastasis Article Snippet: .. For the tet-inducible shRNA expression system, each shRNA sequence was inserted into the Article Title: SPINK2 silencing suppresses leukemic proliferation and restores myeloid commitment via MECOM downregulation in acute myeloid leukaemia. Article Snippet: For this purpose, we interrogated the GPP Web Portal (https://portals.broadinstitute.org/gpp/public/gene/search_clones) and obtained the shRNA that displayed the highest predicted silencing score: shRNA1, TCAGGGAAGGTGGTCATAATA (TRCN0000373635). .. The shRNA was cloned into the Construct:Article Title: KDM5A Inhibits Antitumor Immune Responses Through Downregulation of the Antigen-Presentation Pathway in Ovarian Cancer Article Snippet: .. Tet-inducible knockdown of Kdm5a using short hairpin RNA tet-pLKO-shKdm5a was constructed by inserting the sense sequence 50- CCTTTGAGTGACTTAGAGGAA-30 for clone 1 or 50- CAAAGAGAACAAGACGAGTTA-30 for clone 2 into the Article Title: PHGDH activation fuels glioblastoma progression and radioresistance via serine synthesis pathway. Article Snippet: .. For the inducible knockdown experiments conducted in vitro, lentiviral constructs that carried doxycycline (DOX)-inducible shRNAs were generated in the Sequencing:Article Title: KDM5A Inhibits Antitumor Immune Responses Through Downregulation of the Antigen-Presentation Pathway in Ovarian Cancer Article Snippet: .. Tet-inducible knockdown of Kdm5a using short hairpin RNA tet-pLKO-shKdm5a was constructed by inserting the sense sequence 50- CCTTTGAGTGACTTAGAGGAA-30 for clone 1 or 50- CAAAGAGAACAAGACGAGTTA-30 for clone 2 into the Article Title: A Novel Non-Catalytic Scaffolding Activity of Hexokinase 2 Contributes to EMT and Metastasis Article Snippet: .. For the tet-inducible shRNA expression system, each shRNA sequence was inserted into the Plasmid Preparation:Article Title: KDM5A Inhibits Antitumor Immune Responses Through Downregulation of the Antigen-Presentation Pathway in Ovarian Cancer Article Snippet: .. Tet-inducible knockdown of Kdm5a using short hairpin RNA tet-pLKO-shKdm5a was constructed by inserting the sense sequence 50- CCTTTGAGTGACTTAGAGGAA-30 for clone 1 or 50- CAAAGAGAACAAGACGAGTTA-30 for clone 2 into the Article Title: DDX23 is a Metabolic Regulator in Hepatocellular Carcinoma Article Snippet: Lenti-viruses were produced by co-transfection into HEK293FT cells with the pLKO.1 vectors, packaging plasmid psPAX2 (Addgene plasmid 12260, Addgene, Cambridge, MA) and envelope pMD2.G (Addgene plasmid 12259), using the PEI. .. For the doxycycline (Doxy)-inducible DDX23 knock-down, Article Title: A Novel Non-Catalytic Scaffolding Activity of Hexokinase 2 Contributes to EMT and Metastasis Article Snippet: .. For the tet-inducible shRNA expression system, each shRNA sequence was inserted into the Article Title: SPINK2 silencing suppresses leukemic proliferation and restores myeloid commitment via MECOM downregulation in acute myeloid leukaemia. Article Snippet: For this purpose, we interrogated the GPP Web Portal (https://portals.broadinstitute.org/gpp/public/gene/search_clones) and obtained the shRNA that displayed the highest predicted silencing score: shRNA1, TCAGGGAAGGTGGTCATAATA (TRCN0000373635). .. The shRNA was cloned into the Article Title: PHGDH activation fuels glioblastoma progression and radioresistance via serine synthesis pathway. Article Snippet: .. For the inducible knockdown experiments conducted in vitro, lentiviral constructs that carried doxycycline (DOX)-inducible shRNAs were generated in the Article Title: Tumor Suppressor Folliculin Regulates mTORC1 through Primary Cilia Article Snippet: Anti-gamma-tubulin (Cat# T5326) and acetylated-tubulin (Cat# T7451) antibodies were from Sigma and anti-IFT88 antibody (Cat#13967-1-AP) from Proteintech Group Inc. shRNAs and inducible knockdown cell lines—The targeting sequences of the shRNAs are: FLCN (5’- GATGGAGAAGCTCGCTGATTT-3’), IFT88 (5’- GCTTGGAGCCTATTACATTGA-3’), and LKB1 (5’- GCCAACGTGAAGAAGGAAATT-3’). .. The shRNAs were designed and cloned into Agarose Gel Electrophoresis:Article Title: KDM5A Inhibits Antitumor Immune Responses Through Downregulation of the Antigen-Presentation Pathway in Ovarian Cancer Article Snippet: .. Tet-inducible knockdown of Kdm5a using short hairpin RNA tet-pLKO-shKdm5a was constructed by inserting the sense sequence 50- CCTTTGAGTGACTTAGAGGAA-30 for clone 1 or 50- CAAAGAGAACAAGACGAGTTA-30 for clone 2 into the Purification:Article Title: KDM5A Inhibits Antitumor Immune Responses Through Downregulation of the Antigen-Presentation Pathway in Ovarian Cancer Article Snippet: .. Tet-inducible knockdown of Kdm5a using short hairpin RNA tet-pLKO-shKdm5a was constructed by inserting the sense sequence 50- CCTTTGAGTGACTTAGAGGAA-30 for clone 1 or 50- CAAAGAGAACAAGACGAGTTA-30 for clone 2 into the Polymerase Chain Reaction:Article Title: KDM5A Inhibits Antitumor Immune Responses Through Downregulation of the Antigen-Presentation Pathway in Ovarian Cancer Article Snippet: .. Tet-inducible knockdown of Kdm5a using short hairpin RNA tet-pLKO-shKdm5a was constructed by inserting the sense sequence 50- CCTTTGAGTGACTTAGAGGAA-30 for clone 1 or 50- CAAAGAGAACAAGACGAGTTA-30 for clone 2 into the Clone Assay:Article Title: SPINK2 silencing suppresses leukemic proliferation and restores myeloid commitment via MECOM downregulation in acute myeloid leukaemia. Article Snippet: For this purpose, we interrogated the GPP Web Portal (https://portals.broadinstitute.org/gpp/public/gene/search_clones) and obtained the shRNA that displayed the highest predicted silencing score: shRNA1, TCAGGGAAGGTGGTCATAATA (TRCN0000373635). .. The shRNA was cloned into the Article Title: Tumor Suppressor Folliculin Regulates mTORC1 through Primary Cilia Article Snippet: Anti-gamma-tubulin (Cat# T5326) and acetylated-tubulin (Cat# T7451) antibodies were from Sigma and anti-IFT88 antibody (Cat#13967-1-AP) from Proteintech Group Inc. shRNAs and inducible knockdown cell lines—The targeting sequences of the shRNAs are: FLCN (5’- GATGGAGAAGCTCGCTGATTT-3’), IFT88 (5’- GCTTGGAGCCTATTACATTGA-3’), and LKB1 (5’- GCCAACGTGAAGAAGGAAATT-3’). .. The shRNAs were designed and cloned into In Vitro:Article Title: PHGDH activation fuels glioblastoma progression and radioresistance via serine synthesis pathway. Article Snippet: .. For the inducible knockdown experiments conducted in vitro, lentiviral constructs that carried doxycycline (DOX)-inducible shRNAs were generated in the Generated:Article Title: PHGDH activation fuels glioblastoma progression and radioresistance via serine synthesis pathway. Article Snippet: .. For the inducible knockdown experiments conducted in vitro, lentiviral constructs that carried doxycycline (DOX)-inducible shRNAs were generated in the |